METAGENOMICS

Metagenomics is the study of the metagenome—the collective genome of microorganisms from an environmental sample—to provide information on the microbial diversity and ecology of a specific environment.  Human microbiome analysis is the study of microbial communities found in and on the human body. 

 

The goal of human microbiome studies is to understand the role of microbes in health and disease.  16S rRNA and ITS amplicon sequencing are often used in microbiome and mycobiome analysis, respectively.  The gene encoding prokaryotic 16S rRNA is used in phylogenetic studies in order to identify bacteria present in a community and to map their relationship to each other.  Likewise for fungi and the internal transcribed spacer (ITS) regions located between fungal rRNA genes.  The 16S gene and ITS regions are studied using PCR amplification of hypervariable regions, followed by next-generation sequencing (NGS), to characterize microorganisms to the genus or species level. 

 

The AGCT Core offers amplicon sequencing of several 16S and ITS regions. 

Sample requirements for standard services can be found here For non-standard services, please contact genomics@cshs.org.

Application

Region

Primer

Primer  Sequences (5' - 3')

Bacterial 16S rRNA

V1 – V2

V1 - V3

V3 - V4

8F

357R

27F

534R

341F

785R

AGAGTTTGATCCTGGCTCAG

CTGCTGCCTCCCGTA

AGAGTTTGATCCTGGCTCAG

ATTACCGCGGCTGCTGG

CCTACGGGNGGCWGCAG

GACTACHVGGGTATCTAATCC

Archaeal 165 rRNA 

V3 – V4

ARC344F

Arch 785R

GGACTACVSGGGTATCTAAT

ACGGGGYGCAGCAGGCGCGA

Prokaryote 165 rRNA 

V3 – V4

Pro341F

Pro805R

CCTACGGGNBGCASCAG

GACTACNVGGGTATCTAATCC

ITS1

Fungal ITS

ITS2

ITS1f

ITS2

ITS86F

ITS4

CTTGGTCATTTAGAGGAAGTAA

GCTGCGTTCTTCATCGATGC

GTGAATCATCGAATCTTTGAA

TCCTCCGCTTATTGATATGC